ID: 937738221

View in Genome Browser
Species Human (GRCh38)
Location 2:125316956-125316978
Sequence GAGATGACTTTCCAGTTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937738220_937738221 -8 Left 937738220 2:125316941-125316963 CCAATCTATGAACATGAGATGAC No data
Right 937738221 2:125316956-125316978 GAGATGACTTTCCAGTTGATTGG No data
937738219_937738221 -4 Left 937738219 2:125316937-125316959 CCTTCCAATCTATGAACATGAGA No data
Right 937738221 2:125316956-125316978 GAGATGACTTTCCAGTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937738221 Original CRISPR GAGATGACTTTCCAGTTGAT TGG Intergenic
No off target data available for this crispr