ID: 937738986

View in Genome Browser
Species Human (GRCh38)
Location 2:125326615-125326637
Sequence TTTTATCTTCAGTAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937738986_937738990 10 Left 937738986 2:125326615-125326637 CCTCCCACCTACTGAAGATAAAA No data
Right 937738990 2:125326648-125326670 CTCTCTGACCTTTGAAAATGTGG No data
937738986_937738991 11 Left 937738986 2:125326615-125326637 CCTCCCACCTACTGAAGATAAAA No data
Right 937738991 2:125326649-125326671 TCTCTGACCTTTGAAAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937738986 Original CRISPR TTTTATCTTCAGTAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr