ID: 937739180

View in Genome Browser
Species Human (GRCh38)
Location 2:125329469-125329491
Sequence CAGCATGTTCATCTTTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937739180_937739185 24 Left 937739180 2:125329469-125329491 CCATTTAAAAGATGAACATGCTG No data
Right 937739185 2:125329516-125329538 ATTCTGCTGGGCTCATTCTGTGG No data
937739180_937739181 -2 Left 937739180 2:125329469-125329491 CCATTTAAAAGATGAACATGCTG No data
Right 937739181 2:125329490-125329512 TGACTGCAGATCCTTCTTGAAGG No data
937739180_937739184 12 Left 937739180 2:125329469-125329491 CCATTTAAAAGATGAACATGCTG No data
Right 937739184 2:125329504-125329526 TCTTGAAGGTAAATTCTGCTGGG No data
937739180_937739183 11 Left 937739180 2:125329469-125329491 CCATTTAAAAGATGAACATGCTG No data
Right 937739183 2:125329503-125329525 TTCTTGAAGGTAAATTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937739180 Original CRISPR CAGCATGTTCATCTTTTAAA TGG (reversed) Intergenic
No off target data available for this crispr