ID: 937739590

View in Genome Browser
Species Human (GRCh38)
Location 2:125334076-125334098
Sequence TAGTGAGTTGCCTTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937739590_937739597 16 Left 937739590 2:125334076-125334098 CCCAGCCTCAAGGCAACTCACTA No data
Right 937739597 2:125334115-125334137 CTAGGGAAAGGAAAGAGAACAGG No data
937739590_937739594 -2 Left 937739590 2:125334076-125334098 CCCAGCCTCAAGGCAACTCACTA No data
Right 937739594 2:125334097-125334119 TATGGAGAAACTGTCATTCTAGG No data
937739590_937739596 4 Left 937739590 2:125334076-125334098 CCCAGCCTCAAGGCAACTCACTA No data
Right 937739596 2:125334103-125334125 GAAACTGTCATTCTAGGGAAAGG No data
937739590_937739595 -1 Left 937739590 2:125334076-125334098 CCCAGCCTCAAGGCAACTCACTA No data
Right 937739595 2:125334098-125334120 ATGGAGAAACTGTCATTCTAGGG No data
937739590_937739598 29 Left 937739590 2:125334076-125334098 CCCAGCCTCAAGGCAACTCACTA No data
Right 937739598 2:125334128-125334150 AGAGAACAGGAGTCACTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937739590 Original CRISPR TAGTGAGTTGCCTTGAGGCT GGG (reversed) Intergenic
No off target data available for this crispr