ID: 937745335

View in Genome Browser
Species Human (GRCh38)
Location 2:125405527-125405549
Sequence ATTAATAAGCAGAATGTATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4286
Summary {0: 3, 1: 61, 2: 801, 3: 1324, 4: 2097}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937745335_937745336 -9 Left 937745335 2:125405527-125405549 CCGTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 937745336 2:125405541-125405563 CTTATTAATTCCTTATCACATGG No data
937745335_937745338 24 Left 937745335 2:125405527-125405549 CCGTATACATTCTGCTTATTAAT 0: 3
1: 61
2: 801
3: 1324
4: 2097
Right 937745338 2:125405574-125405596 AATATCTTCTTCCATTCTGTAGG 0: 11
1: 438
2: 3610
3: 15564
4: 17762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937745335 Original CRISPR ATTAATAAGCAGAATGTATA CGG (reversed) Intergenic
Too many off-targets to display for this crispr