ID: 937745727 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:125411519-125411541 |
| Sequence | TACTTCCACCAGAAGTTCTT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937745727_937745729 | -2 | Left | 937745727 | 2:125411519-125411541 | CCCAAGAACTTCTGGTGGAAGTA | No data | ||
| Right | 937745729 | 2:125411540-125411562 | TACAAATTGATTCACCATTGTGG | No data | ||||
| 937745727_937745730 | 5 | Left | 937745727 | 2:125411519-125411541 | CCCAAGAACTTCTGGTGGAAGTA | No data | ||
| Right | 937745730 | 2:125411547-125411569 | TGATTCACCATTGTGGACCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937745727 | Original CRISPR | TACTTCCACCAGAAGTTCTT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||