ID: 937745727

View in Genome Browser
Species Human (GRCh38)
Location 2:125411519-125411541
Sequence TACTTCCACCAGAAGTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937745727_937745729 -2 Left 937745727 2:125411519-125411541 CCCAAGAACTTCTGGTGGAAGTA No data
Right 937745729 2:125411540-125411562 TACAAATTGATTCACCATTGTGG No data
937745727_937745730 5 Left 937745727 2:125411519-125411541 CCCAAGAACTTCTGGTGGAAGTA No data
Right 937745730 2:125411547-125411569 TGATTCACCATTGTGGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937745727 Original CRISPR TACTTCCACCAGAAGTTCTT GGG (reversed) Intergenic
No off target data available for this crispr