ID: 937745730

View in Genome Browser
Species Human (GRCh38)
Location 2:125411547-125411569
Sequence TGATTCACCATTGTGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937745728_937745730 4 Left 937745728 2:125411520-125411542 CCAAGAACTTCTGGTGGAAGTAC No data
Right 937745730 2:125411547-125411569 TGATTCACCATTGTGGACCATGG No data
937745727_937745730 5 Left 937745727 2:125411519-125411541 CCCAAGAACTTCTGGTGGAAGTA No data
Right 937745730 2:125411547-125411569 TGATTCACCATTGTGGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937745730 Original CRISPR TGATTCACCATTGTGGACCA TGG Intergenic
No off target data available for this crispr