ID: 937748656

View in Genome Browser
Species Human (GRCh38)
Location 2:125447078-125447100
Sequence GCAACGGTGGTAGAGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937748656_937748665 23 Left 937748656 2:125447078-125447100 CCCTGAACCTCTACCACCGTTGC No data
Right 937748665 2:125447124-125447146 GCAAGACCTCCTCCTAAGACAGG No data
937748656_937748662 1 Left 937748656 2:125447078-125447100 CCCTGAACCTCTACCACCGTTGC No data
Right 937748662 2:125447102-125447124 TGATGAAAAAACCCAGAGATGGG No data
937748656_937748661 0 Left 937748656 2:125447078-125447100 CCCTGAACCTCTACCACCGTTGC No data
Right 937748661 2:125447101-125447123 ATGATGAAAAAACCCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937748656 Original CRISPR GCAACGGTGGTAGAGGTTCA GGG (reversed) Intergenic
No off target data available for this crispr