ID: 937759968

View in Genome Browser
Species Human (GRCh38)
Location 2:125589415-125589437
Sequence GCCATGAAGTGTAAGCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937759968_937759972 -1 Left 937759968 2:125589415-125589437 CCTGGAAGCTTACACTTCATGGC No data
Right 937759972 2:125589437-125589459 CCTGCAGGGTTTATCTGCCTCGG No data
937759968_937759973 4 Left 937759968 2:125589415-125589437 CCTGGAAGCTTACACTTCATGGC No data
Right 937759973 2:125589442-125589464 AGGGTTTATCTGCCTCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937759968 Original CRISPR GCCATGAAGTGTAAGCTTCC AGG (reversed) Intergenic
No off target data available for this crispr