ID: 937759973

View in Genome Browser
Species Human (GRCh38)
Location 2:125589442-125589464
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937759968_937759973 4 Left 937759968 2:125589415-125589437 CCTGGAAGCTTACACTTCATGGC No data
Right 937759973 2:125589442-125589464 AGGGTTTATCTGCCTCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type