ID: 937763077

View in Genome Browser
Species Human (GRCh38)
Location 2:125628652-125628674
Sequence TTCAGTCAGTGTACATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937763075_937763077 28 Left 937763075 2:125628601-125628623 CCAGTCTCAGTTGTGTCTTCATC No data
Right 937763077 2:125628652-125628674 TTCAGTCAGTGTACATGAGGAGG No data
937763074_937763077 29 Left 937763074 2:125628600-125628622 CCCAGTCTCAGTTGTGTCTTCAT No data
Right 937763077 2:125628652-125628674 TTCAGTCAGTGTACATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937763077 Original CRISPR TTCAGTCAGTGTACATGAGG AGG Intergenic
No off target data available for this crispr