ID: 937770239

View in Genome Browser
Species Human (GRCh38)
Location 2:125712384-125712406
Sequence CTGTGAAATGGGAATGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937770236_937770239 26 Left 937770236 2:125712335-125712357 CCTGACAAGTTCTGTGGTCTAAG No data
Right 937770239 2:125712384-125712406 CTGTGAAATGGGAATGTTAATGG No data
937770235_937770239 27 Left 937770235 2:125712334-125712356 CCCTGACAAGTTCTGTGGTCTAA No data
Right 937770239 2:125712384-125712406 CTGTGAAATGGGAATGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937770239 Original CRISPR CTGTGAAATGGGAATGTTAA TGG Intergenic
No off target data available for this crispr