ID: 937771284

View in Genome Browser
Species Human (GRCh38)
Location 2:125723340-125723362
Sequence GGTCTTCTTCCCTCAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937771281_937771284 14 Left 937771281 2:125723303-125723325 CCAAAGATTTTGAAAATGCGTTT No data
Right 937771284 2:125723340-125723362 GGTCTTCTTCCCTCAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937771284 Original CRISPR GGTCTTCTTCCCTCAAAACC AGG Intergenic
No off target data available for this crispr