ID: 937771421

View in Genome Browser
Species Human (GRCh38)
Location 2:125724653-125724675
Sequence CATTGTCCAAATCTAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937771419_937771421 18 Left 937771419 2:125724612-125724634 CCACTGTCTGTCTTTTTGACTGT No data
Right 937771421 2:125724653-125724675 CATTGTCCAAATCTAGTGTCTGG No data
937771420_937771421 -5 Left 937771420 2:125724635-125724657 CCTCATATGTGTTGACAGCATTG No data
Right 937771421 2:125724653-125724675 CATTGTCCAAATCTAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937771421 Original CRISPR CATTGTCCAAATCTAGTGTC TGG Intergenic
No off target data available for this crispr