ID: 937773409

View in Genome Browser
Species Human (GRCh38)
Location 2:125747918-125747940
Sequence AAAAGCAATGGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937773401_937773409 16 Left 937773401 2:125747879-125747901 CCACATTGTCTACCATCTTAAAG No data
Right 937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG No data
937773404_937773409 4 Left 937773404 2:125747891-125747913 CCATCTTAAAGTGGGCATCTTTC No data
Right 937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG No data
937773400_937773409 22 Left 937773400 2:125747873-125747895 CCAGAACCACATTGTCTACCATC No data
Right 937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG No data
937773399_937773409 23 Left 937773399 2:125747872-125747894 CCCAGAACCACATTGTCTACCAT No data
Right 937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937773409 Original CRISPR AAAAGCAATGGGAAGGTGGA AGG Intergenic
No off target data available for this crispr