ID: 937778628

View in Genome Browser
Species Human (GRCh38)
Location 2:125811173-125811195
Sequence ACTCACCATCGCGGAAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 2, 1: 3, 2: 2, 3: 6, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937778628 Original CRISPR ACTCACCATCGCGGAAGGCC TGG Intergenic
920184314 1:204151061-204151083 CCTCACCATCGCTGCAGGCTCGG - Intronic
921304583 1:213782980-213783002 ACTCACCATTTCGGAAGCGCTGG + Intergenic
923281967 1:232452130-232452152 ACTCACCATCGTGGACTTCCTGG + Intronic
923866686 1:237947217-237947239 ACTCACCATCGCGGAAGGCCTGG - Intergenic
1064742743 10:18449960-18449982 TCTCACCAGCGTGGAAGACCCGG + Intronic
1070813860 10:79311487-79311509 GCTCACCATCGGGGGAGGGCAGG - Intronic
1071342334 10:84660465-84660487 ACTCACCCTCCCAGAGGGCCAGG - Intergenic
1073531044 10:104232231-104232253 ACTGCCCATGGCGCAAGGCCGGG - Exonic
1076068726 10:127469192-127469214 CCTCTCCATCCCGCAAGGCCTGG + Intergenic
1077112013 11:866094-866116 ACCCACGATCGGGGGAGGCCGGG + Intronic
1084064136 11:66693676-66693698 ACTCAGCATCGAGGGGGGCCTGG + Intronic
1087811656 11:102614886-102614908 ACTTACCATCACTGAATGCCAGG + Intronic
1088006683 11:104949537-104949559 ACTCACCACCTCTGCAGGCCTGG + Exonic
1088008939 11:104975350-104975372 ACTCACCACCGCAGCAGGCCTGG + Intergenic
1088010934 11:105000255-105000277 ACTCACCACCTCTGCAGGCCTGG + Exonic
1088013277 11:105029659-105029681 ACTCACCACCACGGCAGGCCTGG + Exonic
1088973428 11:114793564-114793586 GCTTCCCATCGCAGAAGGCCAGG - Intergenic
1091564697 12:1639745-1639767 GCTCGCCCTCGCGGCAGGCCCGG - Exonic
1091706615 12:2697759-2697781 TCTCACCCTCGAGAAAGGCCAGG + Intronic
1102315743 12:111885943-111885965 ACTCACCATCGAGGGAGTGCTGG + Exonic
1105378179 13:19863623-19863645 CCTCACCAGCGCGAAAAGCCGGG - Intronic
1106132281 13:26950564-26950586 ACTCACCAGGGCAGGAGGCCGGG + Intergenic
1118778038 14:68986115-68986137 ACACACCACCGCGCCAGGCCAGG + Intergenic
1119443660 14:74646602-74646624 ACTCACCATGGCAGAATGGCAGG + Intergenic
1120367511 14:83589774-83589796 ACTCACCATCACGGAAGGCCTGG - Intergenic
1122143382 14:99675272-99675294 CCTCGCCATCCCGGAACGCCCGG - Exonic
1132010436 15:98270954-98270976 AGGCACCATTCCGGAAGGCCTGG - Intergenic
1138237799 16:55399896-55399918 ACTCACCATGGCGGCAGGTGTGG + Intronic
1140511893 16:75514649-75514671 AATCTTCATCGCGGAAGGCAAGG - Intergenic
1153012210 18:549357-549379 ACTCAACATCGCAGGAAGCCTGG + Intergenic
1162024934 19:7888506-7888528 ACTCACCCTCGCGGCCCGCCCGG + Exonic
1166673806 19:44727087-44727109 AGCCACCATCACTGAAGGCCCGG + Intergenic
932865178 2:75334188-75334210 TCTCCCCATGGCTGAAGGCCAGG + Intergenic
935820353 2:106887140-106887162 CCCCGCCAGCGCGGAAGGCCGGG + Intergenic
936154164 2:110037358-110037380 AGTCACCATCGGGGCAGGCTGGG + Intergenic
936190520 2:110334057-110334079 AGTCACCATCGGGGCAGGCTGGG - Intergenic
936860994 2:117020459-117020481 ACTCCCCATCGCGGAAGGCCTGG + Intergenic
937778628 2:125811173-125811195 ACTCACCATCGCGGAAGGCCTGG + Intergenic
939293489 2:140224862-140224884 ACTCACCATTGCAGAAGGCCTGG - Intergenic
939509882 2:143092242-143092264 TATTACCATCGCGAAAGGCCTGG - Intronic
1170453849 20:16513723-16513745 ATTTTCCATCGAGGAAGGCCAGG - Intronic
1174978495 20:55362938-55362960 AATCACCATCAGGGAAAGCCAGG - Intergenic
1184984701 22:48121877-48121899 ACACACCATCTGGGAAGGCCAGG + Intergenic
1185402413 22:50625872-50625894 ACTCACCCCAGGGGAAGGCCAGG + Intronic
951887458 3:27538367-27538389 ACTCACCATCCCAGAAGCCTGGG - Intergenic
966871190 3:184291441-184291463 TATCACCCTCTCGGAAGGCCTGG + Intronic
986521293 5:8621098-8621120 TCACAGCATCGCGGACGGCCTGG + Intergenic
987906599 5:24086116-24086138 ACTTACCAGCGAGGAAGGCAGGG + Intronic
988133385 5:27136496-27136518 CCTCACAATCGAGGAAGGCAAGG + Intergenic
997058753 5:130476648-130476670 ACAAACCTTCTCGGAAGGCCGGG - Intergenic
998133281 5:139661766-139661788 ACACAACATGGCTGAAGGCCGGG - Intronic
1001748540 5:174110483-174110505 ACTCACCATCTCCCAAAGCCGGG - Intronic
1006395478 6:33784346-33784368 ACTCACCAGCTTGGATGGCCAGG + Exonic
1012499581 6:99874228-99874250 TCTCACCATCCCTGAGGGCCAGG - Intergenic
1022286478 7:28958912-28958934 ACTTAACAACGAGGAAGGCCAGG - Intergenic
1025230157 7:57198551-57198573 ATTCACCATCACAGAAGGCCTGG + Intergenic
1030077184 7:105746874-105746896 ATTCACCATTGCAGAAGGCAAGG - Intronic
1033645537 7:143300278-143300300 ACTCACCTCCACGGCAGGCCTGG - Exonic
1034016294 7:147590523-147590545 ACTCACCATTCCGCATGGCCAGG - Intronic
1037918857 8:22789961-22789983 ACTCCCCATCCTGGAAGGCCAGG - Intronic
1040377106 8:46836782-46836804 ACTCACCATCGCGGACGCCCTGG - Intergenic
1041136296 8:54762764-54762786 CCTCACTGTCTCGGAAGGCCTGG + Intergenic
1045348337 8:101315199-101315221 ACTCATCATCTCTGCAGGCCTGG - Intergenic
1050434638 9:5596292-5596314 ACTCCCCATCTGGAAAGGCCTGG + Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1057052481 9:91936047-91936069 ACTGACCAGCGCTGAGGGCCGGG + Intronic
1057726773 9:97573576-97573598 ACTCACCATTTCTGAGGGCCAGG + Intronic
1058596971 9:106625359-106625381 ACTGAGCATCACAGAAGGCCTGG + Intergenic
1060103567 9:120859945-120859967 ACTCACAATTGCAGAAGGCCAGG + Intronic
1060283177 9:122227403-122227425 ACTCACCATGGCGGGCGGCGCGG + Exonic
1195035446 X:100967709-100967731 AGTCACCCTAGCTGAAGGCCTGG + Intergenic
1197460157 X:126731013-126731035 ACTTACCATCGCGGAAGGCCTGG + Intergenic