ID: 937781126

View in Genome Browser
Species Human (GRCh38)
Location 2:125838439-125838461
Sequence ACTAGGAAGTTAGGCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937781126_937781133 14 Left 937781126 2:125838439-125838461 CCATGCCTGCCTAACTTCCTAGT No data
Right 937781133 2:125838476-125838498 TAGCTTCACAAGGTTAGTTCTGG No data
937781126_937781131 4 Left 937781126 2:125838439-125838461 CCATGCCTGCCTAACTTCCTAGT No data
Right 937781131 2:125838466-125838488 CTGGCTCCTGTAGCTTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937781126 Original CRISPR ACTAGGAAGTTAGGCAGGCA TGG (reversed) Intergenic
No off target data available for this crispr