ID: 937785210

View in Genome Browser
Species Human (GRCh38)
Location 2:125887757-125887779
Sequence AGTTATCTGCAGAGGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937785204_937785210 16 Left 937785204 2:125887718-125887740 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG No data
937785203_937785210 22 Left 937785203 2:125887712-125887734 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG No data
937785207_937785210 4 Left 937785207 2:125887730-125887752 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG No data
937785205_937785210 15 Left 937785205 2:125887719-125887741 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937785210 Original CRISPR AGTTATCTGCAGAGGATGGC AGG Intergenic
No off target data available for this crispr