ID: 937788327

View in Genome Browser
Species Human (GRCh38)
Location 2:125928717-125928739
Sequence ACTTGAACACTACTGCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937788323_937788327 17 Left 937788323 2:125928677-125928699 CCAGTGCACAAATTGGTGAGGGT No data
Right 937788327 2:125928717-125928739 ACTTGAACACTACTGCCTCATGG No data
937788321_937788327 18 Left 937788321 2:125928676-125928698 CCCAGTGCACAAATTGGTGAGGG No data
Right 937788327 2:125928717-125928739 ACTTGAACACTACTGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937788327 Original CRISPR ACTTGAACACTACTGCCTCA TGG Intergenic