ID: 937790768

View in Genome Browser
Species Human (GRCh38)
Location 2:125958670-125958692
Sequence TCTACCATGTAGAAGGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937790765_937790768 -3 Left 937790765 2:125958650-125958672 CCTTTGTCACCTTTGAAGGTTCT No data
Right 937790768 2:125958670-125958692 TCTACCATGTAGAAGGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937790768 Original CRISPR TCTACCATGTAGAAGGTTGA TGG Intergenic
No off target data available for this crispr