ID: 937792630

View in Genome Browser
Species Human (GRCh38)
Location 2:125978675-125978697
Sequence TGGCAAGGGGCAGGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937792620_937792630 22 Left 937792620 2:125978630-125978652 CCAGAGAAAGCTTTATAAAGAAG No data
Right 937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG No data
937792619_937792630 25 Left 937792619 2:125978627-125978649 CCACCAGAGAAAGCTTTATAAAG No data
Right 937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937792630 Original CRISPR TGGCAAGGGGCAGGGGTGGA TGG Intergenic
No off target data available for this crispr