ID: 937799658

View in Genome Browser
Species Human (GRCh38)
Location 2:126068045-126068067
Sequence CAACCTGCTCACAATGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937799658_937799661 -3 Left 937799658 2:126068045-126068067 CCAATAACATTGTGAGCAGGTTG No data
Right 937799661 2:126068065-126068087 TTGTAGGTGTGTCTCTGGAAAGG No data
937799658_937799662 -2 Left 937799658 2:126068045-126068067 CCAATAACATTGTGAGCAGGTTG No data
Right 937799662 2:126068066-126068088 TGTAGGTGTGTCTCTGGAAAGGG No data
937799658_937799660 -8 Left 937799658 2:126068045-126068067 CCAATAACATTGTGAGCAGGTTG No data
Right 937799660 2:126068060-126068082 GCAGGTTGTAGGTGTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937799658 Original CRISPR CAACCTGCTCACAATGTTAT TGG (reversed) Intergenic
No off target data available for this crispr