ID: 937799661

View in Genome Browser
Species Human (GRCh38)
Location 2:126068065-126068087
Sequence TTGTAGGTGTGTCTCTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937799658_937799661 -3 Left 937799658 2:126068045-126068067 CCAATAACATTGTGAGCAGGTTG No data
Right 937799661 2:126068065-126068087 TTGTAGGTGTGTCTCTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937799661 Original CRISPR TTGTAGGTGTGTCTCTGGAA AGG Intergenic
No off target data available for this crispr