ID: 937800324

View in Genome Browser
Species Human (GRCh38)
Location 2:126074699-126074721
Sequence ACTTATCTGAAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937800324_937800328 22 Left 937800324 2:126074699-126074721 CCTGCCATCTTCTTCAGATAAGT No data
Right 937800328 2:126074744-126074766 CTTGGCTTGTTAGTAAGCTTTGG No data
937800324_937800326 4 Left 937800324 2:126074699-126074721 CCTGCCATCTTCTTCAGATAAGT No data
Right 937800326 2:126074726-126074748 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937800324 Original CRISPR ACTTATCTGAAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr