ID: 937801309

View in Genome Browser
Species Human (GRCh38)
Location 2:126083453-126083475
Sequence ACTGAGATCTTAAGGCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937801309_937801311 7 Left 937801309 2:126083453-126083475 CCAAGGTGCCTTAAGATCTCAGT No data
Right 937801311 2:126083483-126083505 GTCTAAAGTCTCATATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937801309 Original CRISPR ACTGAGATCTTAAGGCACCT TGG (reversed) Intergenic
No off target data available for this crispr