ID: 937801310

View in Genome Browser
Species Human (GRCh38)
Location 2:126083461-126083483
Sequence CTTTAGAAACTGAGATCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937801310_937801314 29 Left 937801310 2:126083461-126083483 CCTTAAGATCTCAGTTTCTAAAG No data
Right 937801314 2:126083513-126083535 AATAATCTCTACAATTAAGGAGG No data
937801310_937801313 26 Left 937801310 2:126083461-126083483 CCTTAAGATCTCAGTTTCTAAAG No data
Right 937801313 2:126083510-126083532 TCAAATAATCTCTACAATTAAGG No data
937801310_937801311 -1 Left 937801310 2:126083461-126083483 CCTTAAGATCTCAGTTTCTAAAG No data
Right 937801311 2:126083483-126083505 GTCTAAAGTCTCATATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937801310 Original CRISPR CTTTAGAAACTGAGATCTTA AGG (reversed) Intergenic