ID: 937801311

View in Genome Browser
Species Human (GRCh38)
Location 2:126083483-126083505
Sequence GTCTAAAGTCTCATATTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937801310_937801311 -1 Left 937801310 2:126083461-126083483 CCTTAAGATCTCAGTTTCTAAAG No data
Right 937801311 2:126083483-126083505 GTCTAAAGTCTCATATTCCTTGG No data
937801309_937801311 7 Left 937801309 2:126083453-126083475 CCAAGGTGCCTTAAGATCTCAGT No data
Right 937801311 2:126083483-126083505 GTCTAAAGTCTCATATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937801311 Original CRISPR GTCTAAAGTCTCATATTCCT TGG Intergenic
No off target data available for this crispr