ID: 937801313

View in Genome Browser
Species Human (GRCh38)
Location 2:126083510-126083532
Sequence TCAAATAATCTCTACAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937801310_937801313 26 Left 937801310 2:126083461-126083483 CCTTAAGATCTCAGTTTCTAAAG No data
Right 937801313 2:126083510-126083532 TCAAATAATCTCTACAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937801313 Original CRISPR TCAAATAATCTCTACAATTA AGG Intergenic