ID: 937801314

View in Genome Browser
Species Human (GRCh38)
Location 2:126083513-126083535
Sequence AATAATCTCTACAATTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937801310_937801314 29 Left 937801310 2:126083461-126083483 CCTTAAGATCTCAGTTTCTAAAG No data
Right 937801314 2:126083513-126083535 AATAATCTCTACAATTAAGGAGG No data
937801312_937801314 -10 Left 937801312 2:126083500-126083522 CCTTGGCTTATCAAATAATCTCT No data
Right 937801314 2:126083513-126083535 AATAATCTCTACAATTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937801314 Original CRISPR AATAATCTCTACAATTAAGG AGG Intergenic