ID: 937808183

View in Genome Browser
Species Human (GRCh38)
Location 2:126169917-126169939
Sequence GCACACCTGCCCAAACGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937808183_937808189 11 Left 937808183 2:126169917-126169939 CCCTCACGTTTGGGCAGGTGTGC No data
Right 937808189 2:126169951-126169973 CAAGGAACTAACAGGACGAACGG No data
937808183_937808187 3 Left 937808183 2:126169917-126169939 CCCTCACGTTTGGGCAGGTGTGC No data
Right 937808187 2:126169943-126169965 GTCCACAGCAAGGAACTAACAGG No data
937808183_937808192 22 Left 937808183 2:126169917-126169939 CCCTCACGTTTGGGCAGGTGTGC No data
Right 937808192 2:126169962-126169984 CAGGACGAACGGGGTGCACTAGG No data
937808183_937808190 12 Left 937808183 2:126169917-126169939 CCCTCACGTTTGGGCAGGTGTGC No data
Right 937808190 2:126169952-126169974 AAGGAACTAACAGGACGAACGGG No data
937808183_937808186 -7 Left 937808183 2:126169917-126169939 CCCTCACGTTTGGGCAGGTGTGC No data
Right 937808186 2:126169933-126169955 GGTGTGCATGGTCCACAGCAAGG No data
937808183_937808191 13 Left 937808183 2:126169917-126169939 CCCTCACGTTTGGGCAGGTGTGC No data
Right 937808191 2:126169953-126169975 AGGAACTAACAGGACGAACGGGG No data
937808183_937808193 28 Left 937808183 2:126169917-126169939 CCCTCACGTTTGGGCAGGTGTGC No data
Right 937808193 2:126169968-126169990 GAACGGGGTGCACTAGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937808183 Original CRISPR GCACACCTGCCCAAACGTGA GGG (reversed) Intergenic
No off target data available for this crispr