ID: 937808184

View in Genome Browser
Species Human (GRCh38)
Location 2:126169918-126169940
Sequence TGCACACCTGCCCAAACGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937808184_937808187 2 Left 937808184 2:126169918-126169940 CCTCACGTTTGGGCAGGTGTGCA No data
Right 937808187 2:126169943-126169965 GTCCACAGCAAGGAACTAACAGG No data
937808184_937808186 -8 Left 937808184 2:126169918-126169940 CCTCACGTTTGGGCAGGTGTGCA No data
Right 937808186 2:126169933-126169955 GGTGTGCATGGTCCACAGCAAGG No data
937808184_937808191 12 Left 937808184 2:126169918-126169940 CCTCACGTTTGGGCAGGTGTGCA No data
Right 937808191 2:126169953-126169975 AGGAACTAACAGGACGAACGGGG No data
937808184_937808193 27 Left 937808184 2:126169918-126169940 CCTCACGTTTGGGCAGGTGTGCA No data
Right 937808193 2:126169968-126169990 GAACGGGGTGCACTAGGATCTGG No data
937808184_937808189 10 Left 937808184 2:126169918-126169940 CCTCACGTTTGGGCAGGTGTGCA No data
Right 937808189 2:126169951-126169973 CAAGGAACTAACAGGACGAACGG No data
937808184_937808192 21 Left 937808184 2:126169918-126169940 CCTCACGTTTGGGCAGGTGTGCA No data
Right 937808192 2:126169962-126169984 CAGGACGAACGGGGTGCACTAGG No data
937808184_937808194 30 Left 937808184 2:126169918-126169940 CCTCACGTTTGGGCAGGTGTGCA No data
Right 937808194 2:126169971-126169993 CGGGGTGCACTAGGATCTGGCGG No data
937808184_937808190 11 Left 937808184 2:126169918-126169940 CCTCACGTTTGGGCAGGTGTGCA No data
Right 937808190 2:126169952-126169974 AAGGAACTAACAGGACGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937808184 Original CRISPR TGCACACCTGCCCAAACGTG AGG (reversed) Intergenic