ID: 937808870

View in Genome Browser
Species Human (GRCh38)
Location 2:126177759-126177781
Sequence GTGCCATGGGCTTATGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937808870_937808878 7 Left 937808870 2:126177759-126177781 CCACTACCATAAGCCCATGGCAC No data
Right 937808878 2:126177789-126177811 CTTTGTCCTGGAAGGAAAAGAGG No data
937808870_937808881 13 Left 937808870 2:126177759-126177781 CCACTACCATAAGCCCATGGCAC No data
Right 937808881 2:126177795-126177817 CCTGGAAGGAAAAGAGGACAGGG No data
937808870_937808879 12 Left 937808870 2:126177759-126177781 CCACTACCATAAGCCCATGGCAC No data
Right 937808879 2:126177794-126177816 TCCTGGAAGGAAAAGAGGACAGG No data
937808870_937808876 -1 Left 937808870 2:126177759-126177781 CCACTACCATAAGCCCATGGCAC No data
Right 937808876 2:126177781-126177803 CATGGCACCTTTGTCCTGGAAGG No data
937808870_937808875 -5 Left 937808870 2:126177759-126177781 CCACTACCATAAGCCCATGGCAC No data
Right 937808875 2:126177777-126177799 GGCACATGGCACCTTTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937808870 Original CRISPR GTGCCATGGGCTTATGGTAG TGG (reversed) Intergenic