ID: 937810430

View in Genome Browser
Species Human (GRCh38)
Location 2:126193824-126193846
Sequence CTGAAACAGAAGTTGATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937810429_937810430 10 Left 937810429 2:126193791-126193813 CCACAAACAGGACGGTTAATGAT No data
Right 937810430 2:126193824-126193846 CTGAAACAGAAGTTGATCACTGG No data
937810428_937810430 11 Left 937810428 2:126193790-126193812 CCCACAAACAGGACGGTTAATGA No data
Right 937810430 2:126193824-126193846 CTGAAACAGAAGTTGATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937810430 Original CRISPR CTGAAACAGAAGTTGATCAC TGG Intergenic
No off target data available for this crispr