ID: 937811017

View in Genome Browser
Species Human (GRCh38)
Location 2:126199214-126199236
Sequence CCAATTTGTGAGTGTTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937811017_937811020 -2 Left 937811017 2:126199214-126199236 CCATGACAACACTCACAAATTGG No data
Right 937811020 2:126199235-126199257 GGAGCTTTCTCTGGCAAACAAGG No data
937811017_937811021 6 Left 937811017 2:126199214-126199236 CCATGACAACACTCACAAATTGG No data
Right 937811021 2:126199243-126199265 CTCTGGCAAACAAGGACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937811017 Original CRISPR CCAATTTGTGAGTGTTGTCA TGG (reversed) Intergenic
No off target data available for this crispr