ID: 937811020

View in Genome Browser
Species Human (GRCh38)
Location 2:126199235-126199257
Sequence GGAGCTTTCTCTGGCAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937811017_937811020 -2 Left 937811017 2:126199214-126199236 CCATGACAACACTCACAAATTGG No data
Right 937811020 2:126199235-126199257 GGAGCTTTCTCTGGCAAACAAGG No data
937811014_937811020 13 Left 937811014 2:126199199-126199221 CCAATCATAGTTTCCCCATGACA No data
Right 937811020 2:126199235-126199257 GGAGCTTTCTCTGGCAAACAAGG No data
937811015_937811020 0 Left 937811015 2:126199212-126199234 CCCCATGACAACACTCACAAATT No data
Right 937811020 2:126199235-126199257 GGAGCTTTCTCTGGCAAACAAGG No data
937811016_937811020 -1 Left 937811016 2:126199213-126199235 CCCATGACAACACTCACAAATTG No data
Right 937811020 2:126199235-126199257 GGAGCTTTCTCTGGCAAACAAGG No data
937811013_937811020 28 Left 937811013 2:126199184-126199206 CCTTCTGAAACTATTCCAATCAT 0: 21
1: 7803
2: 3872
3: 1922
4: 1551
Right 937811020 2:126199235-126199257 GGAGCTTTCTCTGGCAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937811020 Original CRISPR GGAGCTTTCTCTGGCAAACA AGG Intergenic
No off target data available for this crispr