ID: 937811021

View in Genome Browser
Species Human (GRCh38)
Location 2:126199243-126199265
Sequence CTCTGGCAAACAAGGACATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937811014_937811021 21 Left 937811014 2:126199199-126199221 CCAATCATAGTTTCCCCATGACA No data
Right 937811021 2:126199243-126199265 CTCTGGCAAACAAGGACATATGG No data
937811015_937811021 8 Left 937811015 2:126199212-126199234 CCCCATGACAACACTCACAAATT No data
Right 937811021 2:126199243-126199265 CTCTGGCAAACAAGGACATATGG No data
937811016_937811021 7 Left 937811016 2:126199213-126199235 CCCATGACAACACTCACAAATTG No data
Right 937811021 2:126199243-126199265 CTCTGGCAAACAAGGACATATGG No data
937811017_937811021 6 Left 937811017 2:126199214-126199236 CCATGACAACACTCACAAATTGG No data
Right 937811021 2:126199243-126199265 CTCTGGCAAACAAGGACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937811021 Original CRISPR CTCTGGCAAACAAGGACATA TGG Intergenic
No off target data available for this crispr