ID: 937817677

View in Genome Browser
Species Human (GRCh38)
Location 2:126271285-126271307
Sequence GTGGCTGATGCTGCTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937817673_937817677 23 Left 937817673 2:126271239-126271261 CCAGATTGGATGAAGGATCTGTG No data
Right 937817677 2:126271285-126271307 GTGGCTGATGCTGCTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937817677 Original CRISPR GTGGCTGATGCTGCTTTCCT GGG Intergenic
No off target data available for this crispr