ID: 937818703

View in Genome Browser
Species Human (GRCh38)
Location 2:126283501-126283523
Sequence CTTTAGCTGATTAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937818700_937818703 -7 Left 937818700 2:126283485-126283507 CCAAAGATGTTAGACTCTTTAGC No data
Right 937818703 2:126283501-126283523 CTTTAGCTGATTAGGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937818703 Original CRISPR CTTTAGCTGATTAGGGAAAA AGG Intergenic
No off target data available for this crispr