ID: 937819605

View in Genome Browser
Species Human (GRCh38)
Location 2:126294419-126294441
Sequence GGTACCATTGCACTCCAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937819605_937819608 8 Left 937819605 2:126294419-126294441 CCAAGTTGGAGTGCAATGGTACC No data
Right 937819608 2:126294450-126294472 TCACTGCAATCTCCGCCTCCCGG 0: 1611
1: 76578
2: 160750
3: 120470
4: 72250
937819605_937819609 9 Left 937819605 2:126294419-126294441 CCAAGTTGGAGTGCAATGGTACC No data
Right 937819609 2:126294451-126294473 CACTGCAATCTCCGCCTCCCGGG 0: 1516
1: 72588
2: 180899
3: 191791
4: 127302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937819605 Original CRISPR GGTACCATTGCACTCCAACT TGG (reversed) Intergenic
No off target data available for this crispr