ID: 937821999

View in Genome Browser
Species Human (GRCh38)
Location 2:126320718-126320740
Sequence CTAAAACACCTCACTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937821999_937822007 30 Left 937821999 2:126320718-126320740 CCTGGCCAAGTGAGGTGTTTTAG No data
Right 937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG No data
937821999_937822005 13 Left 937821999 2:126320718-126320740 CCTGGCCAAGTGAGGTGTTTTAG No data
Right 937822005 2:126320754-126320776 ATTCAGAGGACAAAACACTGTGG No data
937821999_937822006 22 Left 937821999 2:126320718-126320740 CCTGGCCAAGTGAGGTGTTTTAG No data
Right 937822006 2:126320763-126320785 ACAAAACACTGTGGTTTTTGAGG No data
937821999_937822004 -1 Left 937821999 2:126320718-126320740 CCTGGCCAAGTGAGGTGTTTTAG No data
Right 937822004 2:126320740-126320762 GGCAAAGGGAACAGATTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937821999 Original CRISPR CTAAAACACCTCACTTGGCC AGG (reversed) Intergenic
No off target data available for this crispr