ID: 937822001

View in Genome Browser
Species Human (GRCh38)
Location 2:126320723-126320745
Sequence TTTGCCTAAAACACCTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937822001_937822005 8 Left 937822001 2:126320723-126320745 CCAAGTGAGGTGTTTTAGGCAAA No data
Right 937822005 2:126320754-126320776 ATTCAGAGGACAAAACACTGTGG No data
937822001_937822004 -6 Left 937822001 2:126320723-126320745 CCAAGTGAGGTGTTTTAGGCAAA No data
Right 937822004 2:126320740-126320762 GGCAAAGGGAACAGATTCAGAGG No data
937822001_937822008 26 Left 937822001 2:126320723-126320745 CCAAGTGAGGTGTTTTAGGCAAA No data
Right 937822008 2:126320772-126320794 TGTGGTTTTTGAGGCAAGTAGGG No data
937822001_937822006 17 Left 937822001 2:126320723-126320745 CCAAGTGAGGTGTTTTAGGCAAA No data
Right 937822006 2:126320763-126320785 ACAAAACACTGTGGTTTTTGAGG No data
937822001_937822007 25 Left 937822001 2:126320723-126320745 CCAAGTGAGGTGTTTTAGGCAAA No data
Right 937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937822001 Original CRISPR TTTGCCTAAAACACCTCACT TGG (reversed) Intergenic
No off target data available for this crispr