ID: 937822007

View in Genome Browser
Species Human (GRCh38)
Location 2:126320771-126320793
Sequence CTGTGGTTTTTGAGGCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937822001_937822007 25 Left 937822001 2:126320723-126320745 CCAAGTGAGGTGTTTTAGGCAAA No data
Right 937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG No data
937821999_937822007 30 Left 937821999 2:126320718-126320740 CCTGGCCAAGTGAGGTGTTTTAG No data
Right 937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937822007 Original CRISPR CTGTGGTTTTTGAGGCAAGT AGG Intergenic
No off target data available for this crispr