ID: 937829277

View in Genome Browser
Species Human (GRCh38)
Location 2:126402195-126402217
Sequence CAAATTATGCAGAGGGTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937829272_937829277 17 Left 937829272 2:126402155-126402177 CCATAGCTCCTGGTGTCATTTCC No data
Right 937829277 2:126402195-126402217 CAAATTATGCAGAGGGTCGATGG No data
937829270_937829277 27 Left 937829270 2:126402145-126402167 CCAAGCAGGGCCATAGCTCCTGG No data
Right 937829277 2:126402195-126402217 CAAATTATGCAGAGGGTCGATGG No data
937829274_937829277 -4 Left 937829274 2:126402176-126402198 CCTGCTGAGCACTTCACTGCAAA No data
Right 937829277 2:126402195-126402217 CAAATTATGCAGAGGGTCGATGG No data
937829273_937829277 9 Left 937829273 2:126402163-126402185 CCTGGTGTCATTTCCTGCTGAGC No data
Right 937829277 2:126402195-126402217 CAAATTATGCAGAGGGTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937829277 Original CRISPR CAAATTATGCAGAGGGTCGA TGG Intergenic
No off target data available for this crispr