ID: 937829401

View in Genome Browser
Species Human (GRCh38)
Location 2:126403258-126403280
Sequence TTTGTAGCAGGGCCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937829396_937829401 11 Left 937829396 2:126403224-126403246 CCAAATGTGATACAGCAGGACAG No data
Right 937829401 2:126403258-126403280 TTTGTAGCAGGGCCTGGGCATGG No data
937829394_937829401 19 Left 937829394 2:126403216-126403238 CCAGGCGACCAAATGTGATACAG No data
Right 937829401 2:126403258-126403280 TTTGTAGCAGGGCCTGGGCATGG No data
937829393_937829401 20 Left 937829393 2:126403215-126403237 CCCAGGCGACCAAATGTGATACA No data
Right 937829401 2:126403258-126403280 TTTGTAGCAGGGCCTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937829401 Original CRISPR TTTGTAGCAGGGCCTGGGCA TGG Intergenic
No off target data available for this crispr