ID: 937829405 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:126403270-126403292 |
| Sequence | CTACCTGCTTCCCCATGCCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937829405_937829414 | 9 | Left | 937829405 | 2:126403270-126403292 | CCTGGGCATGGGGAAGCAGGTAG | No data | ||
| Right | 937829414 | 2:126403302-126403324 | GGGCCCATGACAGATGGAGCTGG | No data | ||||
| 937829405_937829417 | 24 | Left | 937829405 | 2:126403270-126403292 | CCTGGGCATGGGGAAGCAGGTAG | No data | ||
| Right | 937829417 | 2:126403317-126403339 | GGAGCTGGACAATGCTTCTTAGG | No data | ||||
| 937829405_937829413 | 3 | Left | 937829405 | 2:126403270-126403292 | CCTGGGCATGGGGAAGCAGGTAG | No data | ||
| Right | 937829413 | 2:126403296-126403318 | GGGCAGGGGCCCATGACAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937829405 | Original CRISPR | CTACCTGCTTCCCCATGCCC AGG (reversed) | Intergenic | ||