ID: 937829414

View in Genome Browser
Species Human (GRCh38)
Location 2:126403302-126403324
Sequence GGGCCCATGACAGATGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937829405_937829414 9 Left 937829405 2:126403270-126403292 CCTGGGCATGGGGAAGCAGGTAG No data
Right 937829414 2:126403302-126403324 GGGCCCATGACAGATGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937829414 Original CRISPR GGGCCCATGACAGATGGAGC TGG Intergenic