ID: 937832987

View in Genome Browser
Species Human (GRCh38)
Location 2:126444222-126444244
Sequence GGCCACGGTGTCAGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937832987_937832993 3 Left 937832987 2:126444222-126444244 CCAGCCACTCTGACACCGTGGCC No data
Right 937832993 2:126444248-126444270 CCTTAGGAAAATAGTTTTATAGG No data
937832987_937832994 29 Left 937832987 2:126444222-126444244 CCAGCCACTCTGACACCGTGGCC No data
Right 937832994 2:126444274-126444296 TAAAAAGAAATAGAAAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937832987 Original CRISPR GGCCACGGTGTCAGAGTGGC TGG (reversed) Intergenic