ID: 937832987 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:126444222-126444244 |
| Sequence | GGCCACGGTGTCAGAGTGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937832987_937832993 | 3 | Left | 937832987 | 2:126444222-126444244 | CCAGCCACTCTGACACCGTGGCC | No data | ||
| Right | 937832993 | 2:126444248-126444270 | CCTTAGGAAAATAGTTTTATAGG | No data | ||||
| 937832987_937832994 | 29 | Left | 937832987 | 2:126444222-126444244 | CCAGCCACTCTGACACCGTGGCC | No data | ||
| Right | 937832994 | 2:126444274-126444296 | TAAAAAGAAATAGAAAAGCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937832987 | Original CRISPR | GGCCACGGTGTCAGAGTGGC TGG (reversed) | Intergenic | ||