ID: 937836775

View in Genome Browser
Species Human (GRCh38)
Location 2:126479191-126479213
Sequence AAACCCCACTTCATAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937836775_937836776 10 Left 937836775 2:126479191-126479213 CCTATCTTTATGAAGTGGGGTTT No data
Right 937836776 2:126479224-126479246 CAGCAGCCAAAATGAGATTATGG No data
937836775_937836778 20 Left 937836775 2:126479191-126479213 CCTATCTTTATGAAGTGGGGTTT No data
Right 937836778 2:126479234-126479256 AATGAGATTATGGAGTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937836775 Original CRISPR AAACCCCACTTCATAAAGAT AGG (reversed) Intergenic
No off target data available for this crispr