ID: 937840172

View in Genome Browser
Species Human (GRCh38)
Location 2:126517364-126517386
Sequence CTGCGGAAAAGCAAAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937840170_937840172 15 Left 937840170 2:126517326-126517348 CCAGATATATATATTCTGATAAA No data
Right 937840172 2:126517364-126517386 CTGCGGAAAAGCAAAGCAGAAGG No data
937840169_937840172 16 Left 937840169 2:126517325-126517347 CCCAGATATATATATTCTGATAA No data
Right 937840172 2:126517364-126517386 CTGCGGAAAAGCAAAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937840172 Original CRISPR CTGCGGAAAAGCAAAGCAGA AGG Intergenic
No off target data available for this crispr