ID: 937841246

View in Genome Browser
Species Human (GRCh38)
Location 2:126526724-126526746
Sequence CTGGCCACTCTGGTTTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937841246_937841251 1 Left 937841246 2:126526724-126526746 CCATCTTAAACCAGAGTGGCCAG No data
Right 937841251 2:126526748-126526770 GTGTGAGCAGCAGCCTCCTGAGG No data
937841246_937841255 12 Left 937841246 2:126526724-126526746 CCATCTTAAACCAGAGTGGCCAG No data
Right 937841255 2:126526759-126526781 AGCCTCCTGAGGTGGGCATAGGG No data
937841246_937841258 30 Left 937841246 2:126526724-126526746 CCATCTTAAACCAGAGTGGCCAG No data
Right 937841258 2:126526777-126526799 TAGGGAAGAAGTGCTCCATGTGG No data
937841246_937841252 4 Left 937841246 2:126526724-126526746 CCATCTTAAACCAGAGTGGCCAG No data
Right 937841252 2:126526751-126526773 TGAGCAGCAGCCTCCTGAGGTGG No data
937841246_937841253 5 Left 937841246 2:126526724-126526746 CCATCTTAAACCAGAGTGGCCAG No data
Right 937841253 2:126526752-126526774 GAGCAGCAGCCTCCTGAGGTGGG No data
937841246_937841254 11 Left 937841246 2:126526724-126526746 CCATCTTAAACCAGAGTGGCCAG No data
Right 937841254 2:126526758-126526780 CAGCCTCCTGAGGTGGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937841246 Original CRISPR CTGGCCACTCTGGTTTAAGA TGG (reversed) Intergenic
No off target data available for this crispr